cagatt gaacaatgct cctgtggctg gctacgaggg agatgtgggc
481 tccaagacca ccatacgtct cttctatcct gagtcggccc actttgaccc taaaatagaa
541 aacaacccag acacgctctt ggtcctggta gctttcaagg cgatggactt ccactggatt
601 gagaccatct tgagtgataa gaagcgggt
Molecular Beacon Primer Design Protocol
http://www.premierbiosoft.com/molecular_beacons/index.html
1. Enter exon sequence.
2. Restrict primer temperature to 59-61ºC.
3. Restrict primer length to 19-21 base pairs.
4. Change the following parameters:
a. Hairpin Max Delta G (3’end) - 2 kcal/mol
b. Hairpin Max Delta G (Internal) - 3 kcal/mol
c. 3’ end max delta G - 10 kcal/mol
d. Self Dimer Max Delta G (3’end) - 5 kcal/mol
e. Self Dimer Max Delta G (Internal) - 6 kcal/mol
f. Run/Repeat (dinucl.) Max Length - 3 bp
g. G/C clamp-Target consec. G/C’s at 3’ end – 1
h. Amplicon Length – 65-75 base pairs
i. Max Ambiguous Bases in Amplicon – 0
j. Max Primer Pair Tm Mismatch – 1C
k. Cross Dimer Max Delta G (3’ end) – 5 kcal/mol
l. Cross Dimer Max Delta G (Internal) – 6 kcal/mol
m. %GC Content – N/A
VALIDATED PRIMER SEQUENCES:
FORWARD: gctcctgtggctggctacg
REVERSE: gggtcaaagtgggccgactc